Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11797G1
Clone ID IST11797G1
Vector VICTR76
Project tigm

Sequence tag IST11797G1BBF1
Sequence
GCCTTGGCTGTCCTGGAACTCACTGCTANACCATGCTATGCCTTGAACTCACTANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121826862..121826921 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]


Sequence tag IST11797G1HMF1
Sequence
GCCTTGGCTGTCCTGGAACTCACTGCTAGACNNTGCTATGCCTTGAACTCACTAGATCTGCCTGCCTCTGCCTCCANAGT
GCTGGGACTAAAAGCATACTCTCCCATCACTACCACTCANCAAATTCTAATGTTTCTAATTTTTAAAACTTTGGCTTAAT
GAGGTATTCACAAATGCTTGCTTTTGAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI32617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121826862..121827052 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es