Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0651
Clone ID CG0651
Vector pGT0lxrT2
Project sanger

Sequence tag CG0651
Sequence
GAATCCAGCGGCTGGCTGGCTGGCGACTAGGCCTCTGTGGCAGAGAATCCGGCGGGAATCTGAGCCATCCGAGCCGCCAC
CATG
Sequence Type mRNA
Unitrap ID UNI1722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130004970..130005053 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027404 (Snrpb) NM_009225 small nuclear ribonucleoprotein B Gene [Source:MGI (curated);Acc:Snrpb-001]

 
Come back to gene ENSMUSG00000027404


For any suggestions or comments, please send an email to unitrap@crg.es