Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q020E02
Clone ID Q020E02
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q020E02
Sequence
TAAAAAACTTTTTACTGCAGAGTCTCTCATTGGCTTGAAAAACCCAGAGAAGTCATTTCCAGTCAACAGTGATGTAGGGG
TACTAAAGTGGAGACTACAAACAACAGAGGAATCTTTTATTCCGTTGACAATTAATTGCTGGCCTTCGGAAAGTGGAAAT
GGCTGTGATGTCAACATAGAGTACGAACTACAGGAAGATAATTTAGAGCTCAATGATGTGGTCATCACTATCCCACTCCC
Sequence Type mRNA
Unitrap ID UNI11912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44558408..44559429 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032096 (Arcn1) NM_145985 archain 1 Gene [Source:MGI (curated);Acc:Arcn1-001]

 
Come back to gene ENSMUSG00000032096


For any suggestions or comments, please send an email to unitrap@crg.es