Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13708F3
Clone ID IST13708F3
Vector VICTR74
Project tigm

Sequence tag IST13708F3HMF1
Sequence
AAGACAAGGAGGGCCAATAGTTCAAGGTCATTCCTGGTTGTATATTGAATTCAGGGCCAGCCTGAGCTGTAAAAAATACT
GTTTCAACACACACACACACACACACACACACACACACACAN
Sequence Type genomic DNA
Unitrap ID UNI19765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63862650..63862769 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036867 (Smad6) NM_008542 MAD homolog 6 (Drosophila) Gene [Source:MGI (curated);Acc:Smad6-001]

 
Come back to gene ENSMUSG00000036867


For any suggestions or comments, please send an email to unitrap@crg.es