Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14319B9
Clone ID IST14319B9
Vector VICTR74
Project tigm

Sequence tag IST14319B9HMR1
Sequence
NNGTAATAGGATGGAGGTCAAACCCAAATGATGGCTGGAGCTGTAGCAAGACCACGTTGGTGATGCCCAGCACAGGGGCA
AAGCCAGTGACCAAGCGCACAGCTGAGGGTGGACAGGCAGGCCAGTCAGTATCACACCCACTAGTGAATAGCGGGTTTCC
TCAGAAGCCTGTCCTGTTGTCTCCTGTACCTGTTCAAAACATGTCTGACACACTGANTTCTTGACTTGTGCCTGAGACTA
NCTTAAACATTTCCTTACNTAANAACTTTGTAAATGATCATCTGANAAAGTTGCTGCTCTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI15400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76333901..76334203 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]


Sequence tag IST14319B9HMF1
Sequence
TTAATGCGTGTTGCAGTTTGTTTCCCAGGTAAAACAACCCTTCCTTGCTGTTGTAAACACAGTTTGCATCACACCAGTGT
TTAAAGATAGCAGGCTTGGCTGCCTAGGATGCTGAAATATCATCAGCTGAATGCAAAGCCCAAGTGATAAATATGAAAAC
ACATAGCTTGGGGCAAGTTAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76334204..76334387 184
 
EST/CDNA Est Name
  AI647209.1 - CD803828.1


Sequence tag IST14319B9BBF1
Sequence
TTAATGCGTGTTGCAGTTTGTTTCCCAGGTAAAACAACCCTTCCTTGCTGTTGTAAACACAGTTTGCATCACACCAGTGT
TTAAAGATAGCAGGCTTGGCTGCCTAGGATGCTGAAATATCATCAGCTGAATGCAAAGCCCAAGTGATAAATATGAAAAC
ACATAGCTTGGGGCAAGTTAAAGTCAACCTTACTGGGGTGCTAAAGAGGTGACTCGGAGGGCAAGAGAGCCTCCTCCTCC
AAAAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76334204..76334453 250
 
EST/CDNA Est Name
  AA600404.1 - AI647209.1 - CD803828.1

 
Come back to gene AA600404.1 - AI647209.1 - CD803828.1


For any suggestions or comments, please send an email to unitrap@crg.es