Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q022C01
Clone ID Q022C01
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q022C01
Sequence
AGTGGCATGANNNNGCAGTTTGGCACCTCGCATGTGTTTAAGTTTGTGGACCCCATCCAGGACCACGTTCTTTCCAAGAG
ATCTGTGGATGGAGGCCTGATGGTCAAGGGCCCAAGACATAAACCTGGAGCTGTTCAGGAGACAACCTTTGAATTGGGAG
GAGATGTCCACAGTGGGACAGCATTGCCGGCAAGCAGGAGCACTACTAGACTGGACAGTGACAGGGTGTCCTCTGCCTCT
AGCACAGCTGAGCGAGGGATGGTGAAGCCGATGATCCGACTGGACCAGGAGCAGGAATATCGACGACGAGAAAACAG
Sequence Type mRNA
Unitrap ID UNI10434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13967012..13972363 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]

 
Come back to gene ENSMUSG00000068036


For any suggestions or comments, please send an email to unitrap@crg.es