Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q015F01
Clone ID Q015F01
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q015F01
Sequence
CAGCCGCCTCCTCCTCTAGCAGGATCATTGGCTTCTACTTTTTGTCCTTCACTCCGCGTAGCACTTAAACAGGATGACTG
AGAGATGCAGCTTTCTCCAGACCAGATCGTCTTGCTTTTGGAGTGGCTCTTAGAGCAGAAGACGCTGAGCCCTCAGACAC
TGCACTGTCTCCAGCAGACTTACCATCTCCCGGAGCAGGATGCAGAG
Sequence Type mRNA
Unitrap ID UNI2350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63372018..63383566 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021458 (2010111I01Rik) NM_028079 RIKEN cDNA 2010111I01 gene Gene [Source:MGI Symbol;Acc:MGI:1919311]

 
Come back to gene ENSMUSG00000021458


For any suggestions or comments, please send an email to unitrap@crg.es