Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14425B7
Clone ID IST14425B7
Vector VICTR74
Project tigm

Sequence tag IST14425B7HMF1
Sequence
CTATCAGGGAAAGAAAAAGATATGGAAGCATCTTTGCCTTGATGTTGAATCTCTGGTTAGAAAATGCTCTGAAGGCAAGC
ATGGTGGTACACACCCTTAATCTCAGCACTTGGGAGGCAGAGGTAGACAGATCTCTTGTGAATTCTAGGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77400718..77400868 151
NO GENE  


Sequence tag IST14425B7HMR1
Sequence
ATAGTCNCTAACCTTTCATTCTGTCTTATTTGTCAGTTTGTATATTGTGTCAATTTGTCTTTATTTTTTTCCTCTAATTT
TAATGTGTATGGGTGTTTTGCCCTTATATATCTCTATATGTGGTCTGTGTACCACATGTGTGTTCTGTGTCTGAGGAGGC
CAGAANAAGGCACCAGATCATCTGGAACTGGAGTTACAGACNGTTGTGAGTCACCATGTGGGTGCTGAAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI19584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77400489..77400721 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]


Sequence tag IST14425B7BBF1
Sequence
CTATCAGGGAAANAAAAANANATGGAAGCATCTTTGCCTTGATGTTGAATCTCTGGTTANAAAATGCTCTGAAGGCAANC
ATGGTGGTACACACCCTTAATCTCANCACTTGGGAGGCANAGGTANACANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017291


For any suggestions or comments, please send an email to unitrap@crg.es