Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q015E08
Clone ID Q015E08
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q015E08
Sequence
ACGCCTCCTCCGTGGGCACCATAGACATGCTTTTGATGGCAGCTATTACATCATTCTGAACTTGGACCGGAAAACATGGA
CTGAGGCAGACAGTACGGCTCAGATCACCCAGCGACAGTGGAAGGCAGAAGGGGTAGGAGAGGGCAGTAGGGCGAGGCAT
CAGAATGGTGCAGTAGTCCAGGGTTTCCAGGACGATGTAAATAGGTAAGTGTGCCCTTTTTAGTGCTCAG
Sequence Type mRNA
Unitrap ID UNI11918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107351..37107493 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es