Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14797A10
Clone ID IST14797A10
Vector VICTR76
Project tigm

Sequence tag IST14797A10HMR1
Sequence
CCATCACACATTAACTCCTCAGCATCCGGGCATGACAGAATAGCGTTTAGGTATCTCAGGATGTGCATAGTTACGCCAGC
TCTCGGTGCGCGGGTCCTAGACTGTTCTGGATTCATCCACAGGTTTTACTCCTCTCCCGTCTCCACCCGAGACGAGGCCG
CTGTCGTTCANCAGCAGAGGAACCTGGAGGTTAAGGAGTCTGACCTTANTAAGAGACTGATCTTAGTTAAGAGTCTATGC
TTAGCAGGGTCAAGACCTGGGTTTGGGTCANGTCCANTCAACACACAAAAGAGAATANNGTGNANAAATTGCANCTTTTT
TTTTTTNNAAAANNTN
Sequence Type genomic DNA
Unitrap ID UNI32626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 145654227..145654558 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036863 (Syde2) synapse defective 1, Rho GTPase, homolog 2 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3036264]


Sequence tag IST14797A10BBF1
Sequence
AGGGAAATTNNNNGTGATACCNNANTACNCAACTGTTGTGTGACAAAATTTGTTCTGGAGAGACAACACGGATATCTACT
CACGCTAGATAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036863


For any suggestions or comments, please send an email to unitrap@crg.es