Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q015E01
Clone ID Q015E01
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q015E01
Sequence
TTTTTTTTTCCCCTCCTGGATGCATTTTGGGAAAGCAGCAGCACCAGATCCAAGATGGCGGCCAGCAGGAGGCTGATGAA
G
Sequence Type mRNA
Unitrap ID UNI2763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201528..17201590 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es