Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10993G10
Clone ID IST10993G10
Vector VICTR76
Project tigm

Sequence tag IST10993G10BBF1
Sequence
ATACTATTCATAATTTTTGCAATACATATGAAGTANGCTTTTAAAAAGGAATTTGGCATTTTTTTGGTGTTAATTTTTTC
TGTATTAAAAACTGTTCATCCGGACATGGTGNTGCACGCTTTTAATCCCAGCACTTAGGAGG

Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855739..97855880 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es