Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q014E05
Clone ID Q014E05
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q014E05
Sequence
GAGNNNTGTGGNNNAATGCCAACTCTTCCAGGACCAGGTGTGCAAGAGCGGAGTGTGTGTGAACACGGCCCCAGGCTACT
CTTGATATTGCAGCAACGGGTTCTACTATCACGCACACAGGCTGGAGTGCGTTGATAATGACGAATGTGCGGACGAGGAG
CCTGCTTGTGAAGGTGGCCGCTGCGTCAACACGGTGGGCTCTTACCACTGTACCTGCGAGCCCCCATTGGTGATGGACGG
CTCCCGGATACGATGCGTCTCCAACGAGAGCCAGAGCATAG
Sequence Type mRNA
Unitrap ID UNI11243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28093944..28094432 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es