Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14370B8
Clone ID IST14370B8
Vector VICTR74
Project tigm

Sequence tag IST14370B8BBF1
Sequence
GACTAAGATGTTAAGGGTCTCAGACAACCTTCTTCCCAGCCCTCCTCAACACCAGGAATAACTGAAATGTATGTATCTGT
CATAGGCCCCTGATCTGGGCACTGACTGCCTTTCAGGGTGTTTATTTTCCTTAAATGGCTGTTCCCTTGACTTCCAAATC
TAGATCCACCTCCAGCACTTACTTGCAATTTTGCAGATTGAGAGGCTCTGAGACCCCTCTGCCATTCATCCTTCAGCCCT
AGATTCCCATCTCCCCTGACTCACCTGCTCCCAGAGGCTCTGCCATGGGCGCTCTCCCTGCTTCTGGGAAGGCCCTCCAC
TCCGCTGCAGCCGGCTCACCTCCCGCCTTANGCTTTGCAGCTCTGTCTGTTGGATCAGTAGTGCGACAGCACAAGTCACA
GCCCCCAGAACTGCCCCCCAACTCAACCNAAGNNCANCCGAAAGGGCTGGCTCTCTGACTGAGCCCCCCATGTGGCCTGG
NNATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69498267..69498751 471
 
EST/CDNA Est Name
  NM_023517.2


Sequence tag IST14370B8HMR1
Sequence
AGTCNAACTCTGGCCCTCTTTCNTGAGCAGAGTCCTGATGTCCTGGAAGCCTGGAAGGATGGGGCGAAATCTCGGAGAAG
GAGAGCAGTACTCACCCAGAAGCACAAGAGTGAGTGAGCCCTGGGGTTTCGGTGCGGTTGGCGGTGACCCAGGAGCACGA
GGGATGCGGAGCANGGCTGAGGTGAGGNTGNNCTCCAGGGCNGGTCC
Sequence Type genomic DNA
Unitrap ID UNI14358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69498065..69498270 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST14370B8HMF1
Sequence
GACTAAGATGTTAAGGGTCTCAGACAACCTTCTTCCCAGCCCTCCTCAACACCAGGAATAACTGAAATGTATGTATCTGT
CATAGGCCCCTGATCTGGGCACTGACTGCCTTTCAGGGTGTTTATTTTCCTTAAATGGCTGTTCCCTTGACTTCCAAATC
TAGATCCACCTCCAGCACTTACTTGCAATTTTGCAGATTGAGAGGCTCTGAGACCCCTCTGCCATTCATCCTTCAGCCCT
AGATTCCCATCTCCCCTGACTCACCTGCTCCCAGAGGCTCTGCCATGGGCGCTCTCCCTGCTTCTGGGAAGGCCCTCCAC
TCCGCTGCAGCCGGCTCACCTCCCGCCTTANGCTTTGCAGCTCTGTCTGTTGGATCAGTAGTGCGACAGCACAAGTCACA
GCCCCCAGANCTGCCCCCCAACTCAACNNAAGAGCAACCGAAAGGGCTGGCTCTCTGACTGAGCCCCCCATGTGGCCTGG
ANATGNNNCTGGCATGANCNNNGGACCCTGCNNNNNGCTGTGGTCTCAGAANTGANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69498267..69498801 499
 
EST/CDNA Est Name
  NM_023517.2

 
Come back to gene NM_023517.2


For any suggestions or comments, please send an email to unitrap@crg.es