Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14294B7
Clone ID IST14294B7
Vector VICTR74
Project tigm

Sequence tag IST14294B7BBF1
Sequence
TTGGCTCTCCCAGCCCAGCCTTACCCTTCTCAGCTTGATCTGCCAAGGGTCTCCTGTCTTGCCATCTTTGAACTGTATCT
TTAGTCTTTCCTGTTTATTCAGAAGTAGTGGGGCTGAGGACACACCCTGGCAGCCAGAGTGCTTGTCTGCAGTTCCTAAA
GCCCTGAGTTCAATCCCCAACACCTCATAAAACCAGGCTTGAGGCGTGGTGGCATATGCTCATCATTTTCCTACCTCAGA
TTTCTGTGTTCTAGGGAATTGAAACCATTAAAAGGGTGGTCAGGAGCAGGGTTTGGTGTTGCAGGATTGTAATTCTAATT
ACTTGGGAGGCTGAGCCNNGAAAAGTGCATGTTTGTCCAGCCTGGGCTTCTAANACCNNGTCTCAAGTAAAAANANNGCT
GGNAATGTANTTNNNGANCN
Sequence Type genomic DNA
Unitrap ID UNI23767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88242988..88243398 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028064 (Sema4a) NM_013658 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A Gene [Source:MGI (curated);Acc:Sema4a-001]


Sequence tag IST14294B7HMR1
Sequence
TGGCGGATTCTGGGGTGATTATTGACACGTCCATGCGAGGGGGGCGTCTCGGCGTATTCTGCTTCTCCCAANAAAACATC
ATTTGGTCCAATCTCCAGTACCGATGCAATGGTGAGCCTCTAGACTGCGGTCC
Sequence Type genomic DNA
Unitrap ID UNI21657

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89030255..89030386 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028047 (Thbs3) NM_013691 thrombospondin 3 Gene [Source:MGI (curated);Acc:Thbs3-001]

 
Come back to gene ENSMUSG00000028047


For any suggestions or comments, please send an email to unitrap@crg.es