Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15082A5
Clone ID IST15082A5
Vector VICTR80
Project tigm

Sequence tag IST15082A5BBF1
Sequence
ATCCCTCCTCAAAGCAAACTCGGAGCGACCGCGTTGTTCCCTTCTGCTTACTGTAACCTATGCACTGGGGAACACTGCAG
TCACCTCTCCTTCCCAGTGGAGGGGGTGAGCTGCCTCACAGCTTCAAACCCCAGCCTCTGGGGATTAGGACAGCTTGAAA
AGGGGTGGGAGTGGCTCTCCCTGCCCACACCCTAATGGTAACTTGAAACCACTATTTGCCCTTAACTCCGCAGCCCCTAA
AAAGCACACCAAATTGTAAACATAAGGAAGTAGGTTTCTGANAAACAGACCCCACTGGAGGAAAAAGGCCGGCCCACTGC
GCANCANGCTCCGGACTGCCCAGTTTGAAAAGCCTTCTCATTCCTTCCTTATTCTCACTCTGCAGCTTCNAAAGCCGANA
GATGCCTAAGGAGCANCNNGANGTGGTTGTACTGNNGTCACCCCNCATCTCN
Sequence Type genomic DNA
Unitrap ID UNI29936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148153754..148154204 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]


Sequence tag IST15082A5HMF2
Sequence
AGGTTAATAACTCATTGTAACTATTTGAAGTTTTGAGAAAGTCATGTAACTTTTCCCCTAATCTTGGTTTGGTTTTTTGT
GAAGTGTTCCCTATCTCAGGGGGGCAGGGTGGTGCATGTCTCTTTTCATCATGGAGAGTCACACACTTGGAGGAATTCTG
TTAGGTCAAGTCTAGGGGAGGCCTGGGAAGCTGGGGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 25171810..25172011 202
NO GENE  

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es