Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14601G11
Clone ID IST14601G11
Vector VICTR74
Project tigm

Sequence tag IST14601G11BBF1
Sequence
TGATGATGAAGCCNGTGGAGGGGAGTGCTGGCTTGGATGGGCTCCAGGACCTTCCTTCCTTCAGCCTAGGAGGGTCCTTA
GTCAAGGACTGGAACTCAGGAGGGATGAGGGGTGAAGCTGAGGATGAGTTTAAGGATGGATGTGGCTTCAGACTTTATTG
TCCCCATGTCANCCCTANTCTATGACTACAAGATGGCCCCACACCCAGGGTCTCCAGGACTTCTTTGCGATGGTATANGT
GGGCCACTTANANGACTCTGCCGCAAGAGGGGCGGNGCNGGGCNNNNCNGGGATGGGAACCCNCCTGGAANANNTTGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14601G11HMR1
Sequence
TCNTCAGGGTCCTGCTGTCTCGGGACTCGTCCTAGGATGATTCTGGAGGATCTGCTGATGGTCCTCAGCTGCCTCAGCTT
GCACGCCCTCTGGAAGGTAACTCTAGCGACTATCCTTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI32631

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109247923..109248043 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070424 (Art5) NM_007491 ADP-ribosyltransferase 5 Gene [Source:MGI (curated);Acc:Art5-001]

 
Come back to gene ENSMUSG00000070424


For any suggestions or comments, please send an email to unitrap@crg.es