Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12260E11
Clone ID IST12260E11
Vector VICTR76
Project tigm

Sequence tag IST12260E11HMF1
Sequence
ATAGGAATGTTAGTACCAANTNTNTACATGTGAGCTTTGGGGGCCAGGTCCTAGAGAGCCCNNNNGGGAGAATGGNANNN
AGGAGATGAAAAACCTGGCCTAGCAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12260E11BBF1
Sequence
ATAGGAATGTTAGTACCAAATTTCTACATGTGAGCTTTGGGGGCCAGGTCCTAGAGAGCCCNNNNGGGAGAATGGTATTT
AGGAGATGAAAAACCTGGCCTAGCAAGAGCTTTTGAGGTGTGTGTGTGTGTGTGTGTATACATATATGTGTGTATATATA
TATATATAN
Sequence Type genomic DNA
Unitrap ID UNI32633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43950562..43950729 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032135 (Mcam) NM_023061 melanoma cell adhesion molecule Gene [Source:MGI (curated);Acc:Mcam-001]

 
Come back to gene ENSMUSG00000032135


For any suggestions or comments, please send an email to unitrap@crg.es