Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12748G2
Clone ID IST12748G2
Vector VICTR76
Project tigm

Sequence tag IST12748G2BBF1
Sequence
CTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10238 UNI31310 UNI31311 UNI31312 UNI31313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2062..2097 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 158115..158150 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069661 (AC140325.3-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 182375..182410 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144675..144710 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3206610..3206645 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3494123..3494158 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3261576..3261611 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4688837..4688872 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004069 (Dnaja3) NM_023646 DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI (curated);Acc:Dnaja3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8056413..8056448 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5299710..5299745 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8219632..8219667 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037669 (1110057K04Rik) NM_172401 RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3251561..3251596 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 16142495..16142530 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12776413..12776448 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6144154..6144189 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273223..3273258 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5681024..5681059 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029757 (Dync1i1) NM_010063 dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI (curated);Acc:Dync1i1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3207925..3207960 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6626128..6626163 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11073370..11073405 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 11835853..11835888 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5486432..5486467 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11321867..11321902 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6417296..6417331 36
NO GENE  


Sequence tag IST12748G2HMF1
Sequence
CTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTCGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGA
ACTCCGGACCTTCGGAAGAGCAGTCGGGTGCTCTTCCTGGTATTCACTTTATANACCAGGCTAGCCTGGAACTCACAGAG
ATCTACCTGCCTCTGCCTCCTGAGTGCTTGGGATTAAATTCTGTGCCNCTCACTGCCTGACTTGGTTCCACCNNANTCTC
TTCNNAAGTGCCAAAAGGTGGGGCTATGGGTCTGTGGTANAGTGCTCNCTGTGCTTGTGCNAAGTCTTGGCCTNANCTCC
NGCATCCCAAGAGAACTGTGGAGGACNNNGGGAACCCTTGANTTTCAAGANTCTANTANCTGCANTCNTNNNNACNGTGC
TNANTNCTGTGTNNNNNNNNAAACTGCTTANACNGTAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029757


For any suggestions or comments, please send an email to unitrap@crg.es