Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15007H3
Clone ID IST15007H3
Vector VICTR78
Project tigm

Sequence tag IST15007H3HMF1
Sequence
AAAGCCAGCGGGGGAGAGGGGGGTANCTGAAACAGTCNTGANTTTCACACCATANNATCTTTTTTAATGCATTTCCTCCT
GCACAGGCATANTTCNTCCTCTGGCANGNNANTANGGGAAAGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15007H3HMR1
Sequence
GCTTTGATTCTCTATTTAGCCTAGGTTAGCTTTGAACTCATGGAGATCTTCTTGTTTCTTGTGTACTGAAATTATAAGCG
TGAGCGCTTACACCTGGCAAGAAGATGCATTTTTACATAATTATTTCCAACTCCTCATAGACTCTTTACTTAACATTAAA
TTAATAGGTTAAGTGAACTGATAGACGGGATTATGAAACTGAAATAAATACTTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI30160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23566735..23566952 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]


Sequence tag IST15007H3BBF1
Sequence
AAAGCCAGCGGGGGAGAGGGGGGTAGCTGAAACAGTCTTGAGTTTCACACCATAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23566680..23566739 60
NO GENE  

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es