Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14534E9
Clone ID IST14534E9
Vector VICTR74
Project tigm

Sequence tag IST14534E9HMR1
Sequence
ATGTTGCTGTTGAAAATATGGCTGTAAAAAGTTTTAAGTACTTTATATTGTGTTTGCATCATGCATTGTATTTCAAGTAA
TACTGAAGTGTGAATTCCAAAAGAGCTGGTGCCTTGTATGTGCCATTAATATAATCACATGAAGGAATATTACACCTTTA
NATCTTTGAATTTTTTTTTTTTCNTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI22080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107123806..107123997 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]

 
Come back to gene ENSMUSG00000049606


For any suggestions or comments, please send an email to unitrap@crg.es