Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q011B02
Clone ID Q011B02
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q011B02
Sequence
AGGCTGGTTGGGTTGGTGAGGCCTGAGGAATAGACTTTTCACTGAGTTGTTTCTATTCTGTAAAATCCAGAATATTAGAG
GGACTTTCCGGCCAGTACAGAGCTCCCTGAAGGCTGGTTGGGTTGGTGAGGCCTGAGGAATAG
Sequence Type mRNA
Unitrap ID UNI11930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59598385..59598445 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051705 (Senp8) NM_027838 SUMO/sentrin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1918849]

 
Come back to gene ENSMUSG00000051705


For any suggestions or comments, please send an email to unitrap@crg.es