Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10052C6
Clone ID IST10052C6
Vector VICTR75
Project tigm

Sequence tag IST10052C6BBF1
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCTGTAACGAG
ATCTGT
Sequence Type genomic DNA
Unitrap ID UNI510 UNI4467 UNI32636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10276964..10277048 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22309074..22309158 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34803411..34803495 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 90263811..90263895 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4069634..4069718 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022186 (Oxct1) NM_024188 3-oxoacid CoA transferase 1 Gene [Source:MGI Symbol;Acc:MGI:1914291]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114789601..114789685 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84916188..84916272 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6107858..6107942 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 6624457..6624541 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56229016..56229100 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60612796..60612880 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26022174..26022258 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39381319..39381403 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16838629..16838713 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20519077..20519161 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4543739..4543823 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94624269..94624353 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71183124..71183208 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29766606..29766690 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026790 (Odf2) NM_013615 outer dense fiber of sperm tails 2 Gene [Source:MGI (curated);Acc:Odf2-002]


Sequence tag IST10052C6HMF1
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACGAG
ATCTGACTCCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAATAAATAAAATCTTAAAAAAAA
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75472909..75473069 161
NO GENE  

 
Come back to gene ENSMUSG00000026790


For any suggestions or comments, please send an email to unitrap@crg.es