Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q009D01
Clone ID Q009D01
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q009D01
Sequence
CACGCACTCACCAACGCCATCCAGGACTCCCTGACTCGATG
Sequence Type mRNA
Unitrap ID UNI11935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35142507..35142547 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es