Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14937F11
Clone ID IST14937F11
Vector VICTR76
Project tigm

Sequence tag IST14937F11HMF1
Sequence
ATAATGCTCTCAGGGAACTTGTAGTGCCCACGGAAAGCTGGCAGAAGTTTGTCCCTGGTCTCTCAAGTGTGGACTGCACA
GATTGGTTCAGTGAACCATGAACAATCCTTCCTGCTCATATAGAGGGAAAAGATGTCAGGAGAAAAGGTATCTGGTCTCG
GAACAACCACCAACCAGCCCTCTGGGCANTTGCCTTCATCNGNNTNTTAAGGACNNNATGANCCCNNANANTCCCATCCC
GGGACTCCCANCAGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14937F11HMR1
Sequence
TTATGTGGNGGGAAACCNTTATTCTCANACCTTGCAATCCTCCCTAGGCTAATTTCCCCTCANTTTTGTCCNAAAGTAAC
TAACTACACATAGCTGGACAAGGCTTCCTAAATGGAGTGTGTTANCCCTTGCCATCGGACCCAGGGGAAATTAACTTATT
CCTTGTTTATTCTCAGGCTAATTAATGAAGGTGCAGTCCTCTGAGGCTGGGAGTTAGGCAAAATGATGCTATCCATGGAC
TGTTTGANGANANANCCTTTTCTTTTGTCTACNCTTTTGTTGATGGGCATCTCTTTTACTGCTGGCTCTGTCCTCAGACC
NTGGGTGGGGGCTGTGTGTGTGTGTGTGTGTGTGTGTGTNTGN
Sequence Type genomic DNA
Unitrap ID UNI24601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113480175..113480536 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031749 (St3gal2) NM_009179 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI (curated);Acc:St3gal2-001]


Sequence tag IST14937F11BBF1
Sequence
ATAATGCTCTCAGGGAACTTGTAGTGCCCACGGAAAGCTGGCAGAAGTTTGTCCCTGGTCTCTCAAGTGTGGACTGCACA
GATTGGTTCAGTGAACCATGAACAATCCTTCCTGCTCATATAGAGGGAAAAGATGTCAGGAGAANAGGTATCTGGTCTCG
GAACAACCACCAACCAGCCCTCTGGGCANTTGCCTTCATCTGTGTATTAAGGACAAAATGAACCCCTANAGTCCCATCCC
GGGAGTCCCANCNNCNTGANGCTCCNANCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113479907..113480178 252
NO GENE  

 
Come back to gene ENSMUSG00000031749


For any suggestions or comments, please send an email to unitrap@crg.es