Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14969G6
Clone ID IST14969G6
Vector VICTR76
Project tigm

Sequence tag IST14969G6HMR1
Sequence
GGGTCACTTGCAGCAGATGGTTTATAAATTTCTGTGCCTAATGTAACTACTCTTTAGTATCTGACTTCCTGTATTGAGTT
TAGCATTAAGTAAACATTANCAAAGAGACTTAATACTTTTTTGGAGTTTAGATCAACTAAGAAAGCTAAAATTCCAAGGC
ATCCATAGGCAGGAAAAGAAATTAAACAGGGTATTTATCCTGGCATTAANTCTTTTGCATTTAAAAGCTTCCTTTGATAA
ACTGCTGGAGTAACCTTTTCGTACCCNNNCNNNCNCNGNTTTTCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108161904..108162198 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]


Sequence tag IST14969G6BBF1
Sequence
ACCCAGGATCTGTCGAGGTCGATCGACGGTATCGATTAGTCCAATTTANGACAGTGCTCGTGACGTTGAATGATGCCAGC
TCATTTACTTACAGTAAGGANACGATTTGGGTCTCCCTGTCTATGCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI35903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82965191..82965271 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041815 (Poldip3) NM_178627 polymerase (DNA-directed), delta interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:1921076]

 
Come back to gene ENSMUSG00000041815


For any suggestions or comments, please send an email to unitrap@crg.es