Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10948D2
Clone ID IST10948D2
Vector VICTR76
Project tigm

Sequence tag IST10948D2HMR1
Sequence
TGTGTTAGTGTATTTGTCTTATTCTGAATTTGTCCTTTTTTTAGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122664116..122664164 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]


Sequence tag IST10948D2BBF1
Sequence
ACACCAAGTTGTAAATAGAGCTCANAAGTTGAGTTGGTGCCCAGCATGTTCTAAGTCCTAGGTTTGCTNTGGCACCAATA
AAAATANAAATAGAAATAAACAATATATATGCCAGGTGTGGTGGTATGCCACCTTTGGTCCCAGCATTCAGGAGGCAAAG
ATAAGTGGGCAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122663943..122664118 170
NO GENE  

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es