Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793D11
Clone ID IST14793D11
Vector VICTR76
Project tigm

Sequence tag IST14793D11HMR1
Sequence
AAGCAACACAGTGTCTGAGAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCNGGAGAAGGTCCAAATACAAGATATCTGC
GCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGAGCACTGAAACTCAGAGGAGAGAATCTGTCTCCCAGGT
CTGCTGATAGACGGTAACAGAATCACCAGAAGAACANTATCTAANCNNANTCC
Sequence Type genomic DNA
Unitrap ID UNI32404 UNI32639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66035925..66036128 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027831 (Veph1) NM_028357 ventricular zone expressed PH domain homolog 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1920039]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103855094..103855297 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046085 (4931422A03Rik) RIKEN cDNA 4931422A03 gene Gene [Source:MGI Symbol;Acc:MGI:1918236]


Sequence tag IST14793D11HMF1
Sequence
NCNNNNNNAGTTNNNNNGTGGTACANACTCGCACCNANNCANACTAAATTCCTAANTTCCTTGGAGTCCCGGGANCAAGA
TGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCTGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046085


For any suggestions or comments, please send an email to unitrap@crg.es