Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0166
Clone ID GC0166
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0166
Sequence
TGTGGAACTTGGTGCCATTGTAGTAGCCCCGCCGAGCCAGCTCCGCGAAGTTCTTGCAGGTCTTGGGCGCATGCTTCCAG
TATAGCTCCAGGACAATGACTCCCATGCTAGTCTCCAGGTAGACGTTGGGCGGCTGCCAGGTGTCTGGGGGAATCGCCGC
CATGCTGAGCGAAGGTA
Sequence Type mRNA
Unitrap ID UNI168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29398730..29400886 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]

 
Come back to gene ENSMUSG00000024007


For any suggestions or comments, please send an email to unitrap@crg.es