Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q008E04
Clone ID Q008E04
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q008E04
Sequence
TACCACAACTCCCATCCAACTCCAAGAGGGAGGGTGGGGGAGGGTCGGGATCCTTCCACGGATAAGTGTGTGGGTCGGTC
TAAGGTCCGCTCGGATCACCGGAAGGAGCGCTGCCAGCCG
Sequence Type mRNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32973117..32973196 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es