Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15062D6
Clone ID IST15062D6
Vector VICTR80
Project tigm

Sequence tag IST15062D6HMF1
Sequence
AAAGTTCATAAAGGAGGTGGAGTTACTGTGGCAGGAAGGGGGCTTTTGTTGTGGTTCAGAAGACAAGGAAACCAAGATCT
GTTTGGGAATCAGAAACCAATGGCAGAGCCCCAGGATGCCCATGTGAATGGGCAGCAAAGTGAGCAGTGTTGCAATGAGT
GCCGTTTCCTTGGAGATTGCCCCCAGTTTTATCCTCTGGGGTATGCCAGGCAATGTCCTGAGGTTTCACATACTCATGTC
TTAACTGTACACAGCAAATGGAAAACACAGGGATGGATGGCAGTGTTGTTCTGTTGCTATATTAGGGCCNGATTGAAGCC
ATCTGCTGGAACAGGCTTGGCAAGGAAGAAACCCCCATGCTTGGCTTAGCAGTAGCATCCTCTTTCCTGCCATTTTTATC
TTTAAGACAGGGTCTTCAGCCNAAGACNACCTTGAACTTCTGATCTCCCTGCTTCCACCTCCCAAGTGCTGAGATTCCAG
TCATCGGCCACCACACCCAGTTTACACAGGGCTAGANACTGTGTGCTTGAGACCAGCATTTTCNCAACTGN
Sequence Type genomic DNA
Unitrap ID UNI9144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49631989..49632538 538
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055653 (Gpc3) NM_016697 glypican 3 Gene [Source:MGI (curated);Acc:Gpc3-001]

 
Come back to gene ENSMUSG00000055653


For any suggestions or comments, please send an email to unitrap@crg.es