Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14757B9
Clone ID IST14757B9
Vector VICTR76
Project tigm

Sequence tag IST14757B9HMR1
Sequence
GTCTACACTAAATTTTGATTAGTAATTACCTTGTTTTTAAAAATATTTTTCTATATTGACATCAGTAACAAAGTTTCATT
TCTATCAAATAAAATTGCTCACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI27652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8517445..8517550 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]


Sequence tag IST14757B9HMF1
Sequence
TAGACTTCAGAATATTTGTTGTAAAATGTATTTTGGAGAAAAGATTTAAAGAGATTGCACCCAATTATGTTCATTTTGAT
AGAAGGACATTCGGTGGCTCACAGTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8517339..8517449 111
NO GENE  


Sequence tag IST14757B9BBF1
Sequence
TAGACTTCAGAATATTTGTTGTAAAATGTATTTTGGAGAAAAGATTTAAAGAGATTGCACCCAATTATGTTCATTTTGAT
AGAAGGACATTCGGTGGCTCACAGTGTCAACCATTTGTTGTTCCTTAGTTCTTGGACAACAGAGAAAATAGCACAGACTT
TAAGACCCCAAGTATAATGGTTGCAGAAGGACGATTGTTAAGTGGGAACTTCTGAAGGCTCTGCAAATGACCCANCAAAG
AGGGAAACTCAGACAGTCTATCACTGAAACAAATCNNCCCTATTACTCACCNGCTTTATATCANANACAGATTTTGGANN
NNATAATTTCCCCNNNGTAAACAAANTTGTANNNNNNNNACTTTGCTNANGATTTTGCTCTGNTNNACNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es