Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13051E9
Clone ID IST13051E9
Vector VICTR76
Project tigm

Sequence tag IST13051E9HMF1
Sequence
GTTTTAAACATGGTCTCTCACTGATTTGTCCAGGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6082676..6082713 38
NO GENE  


Sequence tag IST13051E9HMR1
Sequence
TTTNNGTAACTCTTCCGCCGGGGTGTGGAGGGCAGGGGATGCTCGCCTCTACCTAAAGGAGGTGCTCTTTGAATCTCTCT
CTTCCACTCCAAGTCTCTGTCCCTCACGGGACGAGGGGCATCTTCTTTCCCATGCCGCCCGGCGGACCCCTTCAGGAACG
GTGTCCCCGCCTCCAGCCTCAGTCACCTGGGCGGGCTTTTCCCTCGGTCGGCTCCGTGCCACCTCCCACTTGCACCCTCC
CGGCTCTCCGACCGGGGAGGGGGCGGAGCTCGGCGGGAACCCCTCCCACTTGTNCAATGCANTNNCGAGGGGACGGGGAG
AGAGGTANGTGGGTGTCCANACNCCCAN
Sequence Type genomic DNA
Unitrap ID UNI30119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106724682..106725023 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es