Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14701F9
Clone ID IST14701F9
Vector VICTR76
Project tigm

Sequence tag IST14701F9HMR1
Sequence
NTACAAGTCTTTGTCCTTGGGCTCCTGCTAACAGATTTTAAAATGTAAATCGACAACTGATGGGTGAATGTGAATTTGCT
ACTGTGAATAAATATAGCCAGTAAATATGAGAGACTCCCAGGTTCAGCATCCTAGTGTGAAAATCCAGATGATTTTGTAA
CTTTTCTAGTCTTCTGTCGATGCTACGAATGGAAAATTCCACATATGACAGGTCANANTCC
Sequence Type genomic DNA
Unitrap ID UNI7268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29122770..29122988 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003435 (Supt5h) NM_013676 suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]


Sequence tag IST14701F9HMF2
Sequence
GTACAGGCTGGCACACAGTAGGCAATACATACACACTTCTGGAACAACTGGGGATACCTAAAAACACAAACACGAAAGAA
TCCTAAGAGCTGGGGCTGTCCACCTAGCAGGGCCCTGAACTCAATCCTAGCATCGCAAGTGATAAAAAGTAAACCGAAAG
AAACAAATCANATGAAAGCCAACCGTGGACCTGGCGCACCCCCACCTTCTGGACGCTGCCCCTGCGCTCCACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29122986..29123217 230
 
EST/CDNA Est Name
  AA013620.1 - BY326416.1 - CJ086897.1 - BY325932.1 - BY325493.1 - BY326646.1 - BY110170.1 - BY327755.1 - BY321986.1 - BY147968.1 - BY067674.1 - BY138527.1 - BY074277.1 - BY321699.1 - BY790382.1 - BY323703.1 - BY326616.1 - BY336746.1 - BY125098.1 - BY323642

 
Come back to gene AA013620.1 - BY326416.1 - CJ086897.1 - BY325932.1 - BY325493.1 - BY326646.1 - BY110170.1 - BY327755.1 - BY321986.1 - BY147968.1 - BY067674.1 - BY138527.1 - BY074277.1 - BY321699.1 - BY790382.1 - BY323703.1 - BY326616.1 - BY336746.1 - BY125098.1 - BY323642


For any suggestions or comments, please send an email to unitrap@crg.es