Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0315
Clone ID CG0315
Vector pGT0lxrT2
Project sanger

Sequence tag CG0315
Sequence
GAGAGCGGAAGAAGCTGCGATTCCACNCACGGCAGCTGTACCTGTCGGTGAAGCAGGGGGAGCTGCAGAAGGTGATCCTT
ATGCTGTTAGACAACCTGGACCCCAACTTCCAGAGCGACCAGCAGAGCAAGCGCACGCCCCTGCACGCGGCCGCCCAGAA
GGGGTCGGTAGAGATCTGTCATGTGCTGCTGCAGGCAGGAGCCAACATCAATGCCGTAGATAAGCAACAACGCACGCCAC
TAATGGAGGCCGTGGTGAACAACCACCTGGAGGTGGCACGCTACATGGTGCAGTTAGGTGGCTGTGTCTACAGCAAGGAA
GAGGATGGCTCCACCTGTCTACATCATGCAGCCAAAATTGGGAACTTGGAAATGGTCAGCCTGCTACTGAGCACAGGACA
GGTGGACGTCAATGCCCAG
Sequence Type mRNA
Unitrap ID UNI1735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35043928..35044601 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013787 (Ehmt2) NM_145830 euchromatic histone lysine N-methyltransferase 2 Gene [Source:MGI (curated);Acc:Ehmt2-003]

 
Come back to gene ENSMUSG00000013787


For any suggestions or comments, please send an email to unitrap@crg.es