Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0309
Clone ID CG0309
Vector pGT0lxrT2
Project sanger

Sequence tag CG0309
Sequence
ATCTCACAGCGTGCATCCCTCCTCCATCAGTACACAGGCTCCTTCAAGAAGCCCCCGTTGCGGAGACCCCACAGTGTTAT
TGGAGGAAGCCTTGGTTCCTTCATGGCAATGCCCAGGAATGGAAGCAGACTAGGTAATGTTCTCATTGATCTCGTCTGTG
ACAGAGGATGGAGTCGTCATAGGTTTATGCAGTTGTTATAAGACCAAGTCATTAGCAGTACAGCTGGTCGATGTCCAGGT
GCTCAAGTACCTTTGGGAGTCACCTTCTCAGGGTGTGGAACCCTGGAAGAATTCTGAAGGAATTCCTGTTCGATTTGTTC
ATCCATGCACACAGATGGAAGTAGCCACGATTGGAGGAGAGGAATGTGTCCTTGGTCTGCCTGAACAGGTGTCCGCTTTT
TTATCAATGACACTGAG
Sequence Type mRNA
Unitrap ID UNI1736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56789757..56792634 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028431 (Ikbkap) NM_026079 inhibitor of kappa light polypeptide enhancer in B-cells, kinase complex-associated protein Gene [Source:MGI (curated);Acc:Ikbkap-001]

 
Come back to gene ENSMUSG00000028431


For any suggestions or comments, please send an email to unitrap@crg.es