Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11272A5
Clone ID IST11272A5
Vector VICTR76
Project tigm

Sequence tag IST11272A5HMR1
Sequence
NCANGGCAGAAACCCTTTTGCTTTTTGATCCGAGGGAGCTGGGTTTGAAGCGAGGGAAGTTGGGGGAGGGGGCGAGGAAT
TATTGCCTTACGGTTACCGGACTCCGATTCTTGGCTTAGGGTTTTCCCTTCGCCATAGCCCCCCTTTACCTTCGTAAGAA
CCCCAATCACTCCTACTTCCTGTTGAGGCGTATAGAAATCGCCCTGTATTTGCAAACAAAAGCCCTTGTTGGAGCTTATG
GGACTGTTTTAGGTGTGAAAACTGTCAATTGCTAACCACGGTCTGGGCCCTGCTGTAATTAACTCTGCCAGGGGCTCCTC
CCAACTAAGTCTTATGTTCCTTCGTGGTTTTGTTTTAGGAATATAACTTGCAAATCTAAATTGGGAAGGGGTAGGACNAA
AAATTTCCCACTGAGCCNTAAAGCTGCAGTGCAGGTATCCGTTTCTGGAGGGAGCANTTATCGAAGTCTCTGGGTTTAAN
NCGCNNGGAGGTTTTACTGNGCTTGATTGACAGTACTGATGGTGTCNGTTNNNATTCNNAGGTTGCCCCCTTN
Sequence Type genomic DNA
Unitrap ID UNI15377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44413589..44414139 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es