Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13738B8
Clone ID IST13738B8
Vector VICTR74
Project tigm

Sequence tag IST13738B8HMF1
Sequence
AAAGGAGCGAGCAAACCAGCCTCTGGCTACGAGGAAAGACCCACGTATGCCTCAGGTGAGCGGCTCTTCCAGCCACATTC
AAGATGGCGTCC
Sequence Type genomic DNA
Unitrap ID UNI31736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116168167..116168257 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020792 (Exoc7) NM_016857 exocyst complex component 7 Gene [Source:MGI (curated);Acc:Exoc7-001]


Sequence tag IST13738B8BBF1
Sequence
AAAGGAGCGAGCAAACCAGCCTCTGGCTACGAGGAAAGACCCACGTATGCCTCAGGTGAGCGGCTCTTCCAGCCACATTC
AAGATGGCGTCGACCCGCAGCCCGCTCGCGAGCTCCGGCAGGAACACACTTCCGCCTGCCACTCCCAACATGGCGCCCCC
GAAAGCGTCCGGGGGCGGGGCCGAGGGAGGAAGTGGGCGTGACAGGGACGGAAGCCGAGCAGGGTTTGGAGCTAAAACAG
CGGGGATTGNNNACAGCNCTGTCCGCTGCTATGATTCCCCNGNNNGANGCTTCN
Sequence Type genomic DNA
Unitrap ID UNI31736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116167965..116168257 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020792 (Exoc7) NM_016857 exocyst complex component 7 Gene [Source:MGI (curated);Acc:Exoc7-001]

 
Come back to gene ENSMUSG00000020792


For any suggestions or comments, please send an email to unitrap@crg.es