Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14543H5
Clone ID IST14543H5
Vector VICTR74
Project tigm

Sequence tag IST14543H5HMR1
Sequence
TCTTAAGAATGTTAGGTCAGATACAGGGGCAGACAATGGAATACTGTCAGTGGACTAAGGTANCCCAANNTCATTTTGAC
TCCTATCTTTTCACAATCAGTTGATAGCCATGGCACTATGGGTAACAGAGGTGTGTCTTTGCCCTCATTTGTTCTCTTGC
TATGAAATANATGTANCTCTTCACAGGTAAAAAACTGAGGTTCCTGATGAATCTGCTCCAGCCAGCTCATGCCATCCAAG
CAAGGCTAGCCTTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI10187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83357538..83357795 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]


Sequence tag IST14543H5HMF2
Sequence
AAGACTATTAGGTAAACCCCTTTGGAATGCAATAACAGACCCCTAGCTTCCATCAACCTAAGAATGTCATTAGATAGCAT
CTGAGACCTGGAGCGGAGGCCCGCCTGCCTGTTACTTCCACCCACATAAATGAAAAGGGCCTTTCGGGCTAGTTCTTTGT
TCTCTTACTACAAACACTGTGTTCAACTATTACCACATAGGAACACAGTGTCTGGGGTGACCTGAATCTGTGTCCCCGGG
CCGCAGCCATTCTTATTTGGCCCAGAATAAACTGTCTCACTCCCTCTGGGGTAAAAGTTGTGTTTTTACACTAAAGAAGC
CGCTGACGCACAGCATGTAGGGCTAATGAACACACTTCAGACCTCCCAGCTCCCAGCTCTTCTCTCTGATGCAAGTCTCA
GGGACCAAAGTCCTTCTCTATGGTAACACCTCCTTGGANGTCACCCTGCACAGCCCTGGTAGACATTCTGTNANNTTCCC
TGGCAAATAAAAGCCNGANAAGTTAAAAAGTTCTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83357026..83357541 504
NO GENE  


Sequence tag IST14543H5BBF1
Sequence
NNNNGTTTGCTTACTTGGTTGCTTGCCTTTTGAGTCAGGGTTTCTGTCTGTAGCTCTGGCTCTCCTAGAACTCGCTCTGT
AGACCAGGCTGGCCTCAAACTTAAAAGAGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30641249..30641360 112
NO GENE  

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es