Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14960H12
Clone ID IST14960H12
Vector VICTR76
Project tigm

Sequence tag IST14960H12BBF1
Sequence
NNCNGANANGCGGTAAGGGCNGGANTGGTGAAAAAANAAANGAANANAANACACAANTAACCTGGCTTTTAAAATANGCT
TGCTTTCTNACNCCNNGCCTTTTNGGTTCACTANGGANGANCCTGTTGATCNGTCNTTTCTTGCCACACTATTGCTCTTT
TCTTTNATNNGANACNTGGTATCATGANGCTTGTCTTGATTCNNNNNNCCTACTCCCCAAGTGCCGGGCTTATNACCTTG
CCGCCCTGCNTCACACCNTGCNAATGTGTTTACTAANCAATAACTCTTGCTNATACATGTTAGACATTTATATTTTTACT
CATTANCNTANCTAATCNNATTCTGTGTCCNCTTACANTTGCTTACTTTTAANCTCTTTCTTCACACNGTCNCTTNCCNT
TTTATTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14960H12HMR1
Sequence
GCTTATCTAAGATGAGAAGGGAAGAAGGGCTAATTCCTGTCATTCCAGAGTTGGGAAGGTAGTATCNAGCCTTTGAGAAG
CTGGGGGAAGGAAGGCCGAGAAGGACAAGGGCTAGAACGGTACCGCCTTGT
Sequence Type genomic DNA
Unitrap ID UNI27392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79962686..79962816 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]


Sequence tag IST14960H12HMF1
Sequence
AGCAGANAGGCGGTAAGGGCTGGAGTGGTGAGAAAAGAAAGGAAGAGAAGACACAAATAACCTGGCTTTTAAAATAGGCT
TGCTTTCTGACACCAGGCCTTTCTGGTTCACTAGGGAGGAGCCTGTTGATCTGTCGTTTCTTGCCACACTATTGCTCTTT
TCTTTCTTCTGAGACGTGGTATCATGAGGCTTGTCTTGATTCTCCTGTCCTACTCCCCAAGTGCCGGGCTTATAACCTTG
CCGCCCTGCATNACACCATGCATATGTGTTTACTAAACANTANCTCTTGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79962398..79962688 281
NO GENE  

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es