Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14754F8
Clone ID IST14754F8
Vector VICTR76
Project tigm

Sequence tag IST14754F8HMF1
Sequence
ACNACCTCGTGCGTGATCGTGTCACCTGGAGGCTACGCGCTCAGCGCCGCGTACGCGCACCCTACCCAGTGGTGGAAGGT
ATGCACATCCTTGGGAGACAGGAATTTTGGGGTGCTGCCTAATCCTTGTCA
Sequence Type genomic DNA
Unitrap ID UNI21331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87584358..87584487 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008167 (Fbxw9) NM_026791 F-box and WD-40 domain protein 9 Gene [Source:MGI (curated);Acc:Fbxw9-001]

 
Come back to gene ENSMUSG00000008167


For any suggestions or comments, please send an email to unitrap@crg.es