Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14826F3
Clone ID IST14826F3
Vector VICTR76
Project tigm

Sequence tag IST14826F3HMR1
Sequence
TGTACTANTTACTTTTTCAGGGGACCTGGGTTCAATTCCCAGTACCTACATGTCAGTTCACAACTATCTCTAGGTCCAGG
GGATCTGACACCCTCACACAGACATAAATACAGGCAGAGCACCAATGTACATAAAAGATAAATAAAAAGGAAC
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119494734..119494885 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]


Sequence tag IST14826F3BBF1
Sequence
CCTGCAAGTTCTTTACAGTGAAGTGATTTTTATTTTTAAAAACTATACAAGATCCTAAATACTTCTACAAATTATACCTA
CCAGTATTCAGCATTATAGATAATACATGAAGTTTTTTCACCTTCATTAATTCACTTATAATTAATAACAAATACATCTA
TTGTTAACATAAATGACATATTTTTNCNAAAATCTCTATCTTGCCNNANAAAAACTTNNTTTGTGATNANAATGGANGTT
TCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14826F3HMF1
Sequence
CCTGCAAGTTCTTTACAGTGAAGTGATTTTTATTTTTAAAAACTATACAAGATCCTAAATACTTCTACAAATTATACCTA
CCAGTATTCAGCATTATAGATAATACATGAAGTTTTTTCACCTTCATTAATTCACTTATAATTAATAACAAATACATCTA
TTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119494535..119494702 168
NO GENE  

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es