Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11175D6
Clone ID IST11175D6
Vector VICTR76
Project tigm

Sequence tag IST11175D6BBF1
Sequence
TGAGCCGCGGGCTCCATGGATGGAGCACGAGGGGCGGGAGTATTGGGAGCGGGAGACACAGATCGCCAAGCGCAATGAGC
AGAGTTTCCGAGGGAGCCTGAGGACCGCGCAGCGCTACTACAACCANNNTGAAGGCGGTGAGTGACCCTGGGTGGGAGGT
CACGAGCTCGAAATGTCCCTAGNCAGGGGCCGGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36282271..36282469 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073403 (CT030728.6-202)  

 
Come back to gene ENSMUSG00000073403


For any suggestions or comments, please send an email to unitrap@crg.es