Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W208D01
Clone ID W208D01
Vector ROSAbetageo
Project ggtc

Sequence tag W208D01
Sequence
CCCGGGGGANAGGACCCAGTTTAAAATACAATAATGNNNGTNNNNTTAATAGAAATGACTGAANNNNAGGTGTGAGCCGT
ACCTGTGATAACTAAAGGATTCGAGTACAATGCTTTCTTTTTGGTCAGAGAGATGCCCTTGCTTAGCCAGAGCCTTAGAA
TGAAATGAAATGAAATGAGTGCGGGAGTGGTTGAGGAGTAACCAGAGTGAATCTTGTTTGCTCTTTAGAAACCAGCGATG
TATCCGTCTTGAGACGTGACTCCTTTCTCTTTAGAGCTATTCTTGTTTTGTTTCTCCTTGTTTTGTTAAATACTGCAACC
TCTTTGTTAAATTGTGCCTAATGTGTGGTAAGCGAGAGCTCCACGCCTCCGTTTTCACCAGCTTTTGATAATGTATTCTA
TACACGCTGCTCTTAAGAAAAACACGTGGTTCCAAGAAACCATGGACTTCTGTCTGCAGTGAATGGGAGGCTCCTGTGGA
G
Sequence Type mRNA
Unitrap ID UNI11955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97088490..97088958 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062797 (l7Rn6) NM_026304 lethal, Chr 7, Rinchik 6 Gene [Source:MGI (curated);Acc:l7Rn6-001]

 
Come back to gene ENSMUSG00000062797


For any suggestions or comments, please send an email to unitrap@crg.es