Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14304A11
Clone ID IST14304A11
Vector VICTR74
Project tigm

Sequence tag IST14304A11HMF1
Sequence
AGGAGAACCGAGGAGTAGGGCGGACTAGAGTGACACTTAAGTCTTCAGCCCTCTTGGTGATCCTTCCTAGGTGCAGACAA
TTCGGCAGACTATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI32468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985889..134985986 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030805 (Stx4a) NM_009294 syntaxin 4A (placental) Gene [Source:MGI (curated);Acc:Stx4a-001]


Sequence tag IST14304A11BBF1
Sequence
AGGAGAACCGAGGAGTANGGCGGACTANAGTGACACTTAANTCTTCAGCCCTCTTGGTGATCCTTCCTAGGTGCAGACAA
TTCGGCAGACTATGGCCNAACTGGAGAGTAAAGTCCGGGAGTTGGAGAAACAGCAGGTCACCATCCTGGCCACGCCTCTT
CCCGAGGAGAGTAAGCGAAACCTAGGGCTCACGCACGCCAGCCCGGTGGACTATGGGGGATGTAGTTTTATTCANGTGAT
GGCCAGGATGGGTTTGGTTTTGGTTTGTGGNANANGCTGTGATTNANAANTGTTGGCTTN
Sequence Type genomic DNA
Unitrap ID UNI34405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985889..134986187 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030805 (Stx4a) NM_009294 syntaxin 4A (placental) Gene [Source:MGI (curated);Acc:Stx4a-001]


Sequence tag IST14304A11HMR1
Sequence
TCCTGACCCTTACCTTCTGGAAGAACTCGTCGTCCGGGCTGCCCAACCGGGCAGCACCTGAGTGCACCACCAGCGCGACT
CGAACCTCATCTTCATCGTCTGAGATGTTATCCCCCTGCCAGGGCCGGAGTCATTGGCGACAGTTGCTCGCTGCGGTTCT
CGCCCCGCAGGAACCATGGGCTTCCGGGATTTTCCTTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985694..134985892 199
NO GENE  

 
Come back to gene ENSMUSG00000030805


For any suggestions or comments, please send an email to unitrap@crg.es