Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14790A5
Clone ID IST14790A5
Vector VICTR76
Project tigm

Sequence tag IST14790A5HMF1
Sequence
GCTCCTAAGTGCTGGTATTTCAGGTATGTATTACCACACCTGGTTTAGCAAATACTAGTTTTTCAAACAAAGTTCCTGCC
TTTTGCTTAAGAATCCCTCTTACGGAGTCACTGCTGGGTGATTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114415010..114415134 125
NO GENE  


Sequence tag IST14790A5HMR1
Sequence
GGAGCCNGAGGCAGAAGTAGAAGTTTAGGGTCCTCTTGCAAATTCACACAGAGTGCAGCTTGCACTGGGCAGAAGTTCAG
GCCACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114414926..114415014 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST14790A5BBF1
Sequence
GCTCCTAAGTGCTGGTATTTCAGGTATGTATTACCACACCTGGTTTAGCAAATACTAGTTTTTCAAACAAAGTTCCTGCC
TTTTGCTTAAGAATCCCTCTTACGGAGTCACTGCTGGGTGATTGGCCATGTCTGAGCTGCCCGGGCTTTTGAGGGTCCTG
CCTCTTTGCTTCCTGCTCTGTGATCGTANGACCANGCNATCTCNNTANNCCNCNNTTCACTCATCTGTTAAANGGGGANA
ATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es