Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W195B04
Clone ID W195B04
Vector ROSAbetageo
Project ggtc

Sequence tag W195B04
Sequence
ACACGAAACGCCGACGCCTTTGCTCCCGGAAGGGATCGCTTCGTCGGTCGTGCGCACGCGCGCGGCGAAACCGCGGCCTT
GGCGGAGATTAAACCCGGATAGCGAGGCCCTTAGCGTTGGTGAGGAGCTGCACAGTTTGTCGGTGGCGGCTGCTCCGTCG
GGGAGGCTTGAAG
Sequence Type mRNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80261379..80261550 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]

 
Come back to gene ENSMUSG00000020211


For any suggestions or comments, please send an email to unitrap@crg.es