Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14485C5
Clone ID IST14485C5
Vector VICTR74
Project tigm

Sequence tag IST14485C5BBF1
Sequence
ATAGGGTCATGAGACAGGGGTTCTCCTTCCATTGTTTGGAATCTTTAAAGAACATTTCCATGTAGTAACACATTTTTAAC
TAGTCAGAAGGCTCATGCCAGCTAGTCATCAGATGTGATTTTTTTTTNCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI18157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11456517..11456649 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]


Sequence tag IST14485C5HMF1
Sequence
ATAGGGTCATGAGACAGGGGTTCTCCTTCCATTGTTTGGAATCTTTAAAGAACATTTCCATGTAGTAACACATTTTTAAC
TAGTCAGAAGGCTCATGCCAGCTAGTCATCAGATGTGATTTTTTTTTTCCCCCAAAAAAAATATTTTTACNAN
Sequence Type genomic DNA
Unitrap ID UNI18157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11456517..11456666 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

 
Come back to gene ENSMUSG00000040720


For any suggestions or comments, please send an email to unitrap@crg.es