Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14661C5
Clone ID IST14661C5
Vector VICTR74
Project tigm

Sequence tag IST14661C5HMR1
Sequence
AGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATTTCTCTCNTTTTTGTCTTTTA
AGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079332 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789402 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24048279..24048414 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749588..124749723 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356494..91356629 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940364 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919857..52919992 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469638 134
NO GENE  


Sequence tag IST14661C5BBF1
Sequence
NCCTTTATTTTNNAAATCTAATATTTTAATGTCAAAGAGTTTAATAAATGCTTTATAGTATCTTAAAGGGATCTACTTAT
TGGCTTATAGATTGATCCTAAAACAGCTACCTTATTAGAAAAGGGAAAAACAGGTTTTCTCCNCAAAACGCTTCAAAAAC
ATATTAATTCGTGTGACNAGCTGGTNGGTAAGTTGACTCATGTCCTGATTGNATTGACTAAAAAACTAAATTAAATTNNN
GNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469636..7469871 224
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919624..52919859 224
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940362..136940597 224
 
EST/CDNA Est Name
  BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777267..115777502 224
NO GENE  


Sequence tag IST14661C5HMF2
Sequence
ACCTTTATTTTCAAAATCTAATATTTTAATGTCAAAGAGTTTAATAAATGCTTTATAGTATCTTAAAGGGATCTACTTAT
TGGCTTATAGATTGATCCTAAAACAGCTACCTTATTAGAAAAGGGAAAAACAGGTTTTCTCCACAAAACGCTTCAAAAAC
ATATTAATTCGTGTGACGAGCTGGTAGGTAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469635..7469828 194
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919667..52919860 194
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940361..136940554 194
 
EST/CDNA Est Name
  BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777266..115777459 194
NO GENE  

 
Come back to gene BI789805.1


For any suggestions or comments, please send an email to unitrap@crg.es