Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14596G1
Clone ID IST14596G1
Vector VICTR74
Project tigm

Sequence tag IST14596G1HMR1
Sequence
TGGCACACACCCTGCAGCTCCATTATGAGCCTCCTCACCAGATTCCTGTTAGCAAAGTTAGGATCGCTGGGGCTGGAGAG
AAGGCTCAGGGGTTAGAGCACTGGCTGTTGTTGTGGAGGACCTGGGTTCGGTTCCCAGCTCTTACGTGGTANCTCCCGAC
CACCTGTGACTCCAGTGTCAGGAGACTATATACCTTCCTTTGGCCTCCCCGGGCATTGCATGGAAGTANTTGATANACAC
ATGTACTGGCAAAGTTATCTGTACACATAAAATAAAAATAAAGTTCCNAAACATTTAAACAAATTATNTTGCCTTCCNAN
ACTTTTCTGATGGATTGTTTAANCTGAGTTGTTNGGAACAAGACCNGNNGTGNANAANANANAN
Sequence Type genomic DNA
Unitrap ID UNI16407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147578262..147578638 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029640 (Usp12) NM_011669 ubiquitin specific peptidase 12 Gene [Source:MGI (curated);Acc:Usp12-001]


Sequence tag IST14596G1BBF1
Sequence
ATAGCCCAGGAGGCGCCAACACAGCAGTGAGGAGACAGCACTCCACAGTCCAGTAGCTCTACTCAGTGTGTGTCCCATAC
CACAGACATTCAAAAGCTTGTTCATCCTGCAAGCTCCTCACCAGCAAAAACCACGGACCTACTCACACAACTATAGGATC
AAAGTTCAAAACAATGTTTTCAAAGAATTTAGCTAATAAAAGTTTTAAAACAGATTAAACAAAACCAAACCAACCTATAA
CTAAAGCTAGATTAAGCAGGCGATGATTAACAATGCTGAGAATCATCCCATTTGTCTCCTGTAGGCTAGTCAGCTGTCTG
TCTTAACTGCTGTGCAAACACAAAGGCCCTGGCTCCCACAGGTGAGTGCTTGTTGATGACCCTACCCACATAGTCCAAAA
GGGACCCCCGTAAGGCAGGTCTAGCANCAATTCTTCCTTATGTACTTCCCGGAAAAGCAAAGCANCCTGGGAATGCAGCT
ACNTNNNNCTGATGGGAGNAGCTCTCCCTTANACCCNAAANTGTCTTCCCCTCCTGCAACCCCCCTGCANTTGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147578657..147579213 529
 
EST/CDNA Est Name
  BF467004.1 - CK635021.1 - BY710126.1 - BY722278.1 - BG144478.1 - AW822773.1 - AI552551.1 - CF533324.1 - AW046996.1 - CJ171526.1 - CJ168236.1 - CJ185113.1

 
Come back to gene BF467004.1 - CK635021.1 - BY710126.1 - BY722278.1 - BG144478.1 - AW822773.1 - AI552551.1 - CF533324.1 - AW046996.1 - CJ171526.1 - CJ168236.1 - CJ185113.1


For any suggestions or comments, please send an email to unitrap@crg.es